ifitm2 human reverse Search Results


97
Quanta Biosciences hsa let 7f 1 5p tgaggtagtagattgtatagtt perfecta universal pcr primer
Hsa Let 7f 1 5p Tgaggtagtagattgtatagtt Perfecta Universal Pcr Primer, supplied by Quanta Biosciences, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ifitm2+human+reverse/pmc08990073__41467_2022_29526_MOESM1_ESM-84-45-52?v=Quanta+Biosciences
Average 97 stars, based on 1 article reviews
hsa let 7f 1 5p tgaggtagtagattgtatagtt perfecta universal pcr primer - by Bioz Stars, 2026-07
97/100 stars
  Buy from Supplier

86
Eurofins ifitm2 human reverse
MYCT1 is a transmembrane phosphoglycoprotein that interacts with <t>IFITM2/3,</t> related to Fig. 5 . (A) The MYCT1 protein is highly conserved across vertebrates. An alignment of human MYCT1 protein sequence with those of the indicated species, amino acid conservation is color-coded as indicated in the legend below. Percentages next to species indicate amino acid sequence identity (left) and homology (right) in comparison with human sequence. (B) Short MYCT1 isoform is predominant in ECs. Cells were transduced with Ad- GFP (control) or Ad- MYCT1 (187-aa isoform with C-terminal V5 tag) adenoviruses. Western blot analysis for the indicated proteins. (C) Workflow for mass spectrometry experiments. MYCT1-negative SW480 colon cancer cells were used to exclude nonspecific interactors pulled down by MYCT1 IgG. n = 2 independent experiments. (D) Venn diagram showing how the short list of MYCT1 interactors was selected. (E) Interaction between MYCT1 and IFITM2/3 was analyzed by PLA in ECs. siRNA-mediated knockdown of either protein confirmed specificity of PLA signal. Staining of ECs for PLA dots (gray), VE-cadherin (magenta), and DNA (blue). Scale bar, 50 µm. (F) Quantification of the number of PLA dots per cell in control, MYCT1 KD , and IFITM2/3 KD cells. n = 3 independent experiments; 500–1,500 cells were analyzed per condition for each experiment; mean ± SD; one-way ANOVA with Dunnett’s multiple comparisons, P = 0.036 (*) for MYCT1 knockdown effect. (G) Positive control (VE-cadherin::β-catenin) and negative control (MYCT1 antibody alone) for PLA signal in human brain sections. PLA dots (gray) and staining of ECs for VE-cadherin or Pecam1 (magenta) and DNA (blue). Arrowhead, colocalization of PLA dots with vascular marker. Scale bar, 20 µm. Source data are available for this figure: .
Ifitm2 Human Reverse, supplied by Eurofins, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ifitm2+human+reverse/pmc13016079-121-0-4?v=Eurofins
Average 86 stars, based on 1 article reviews
ifitm2 human reverse - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier

90
Meridian Bioscience sensifast 2 sybr lorox kit
MYCT1 is a transmembrane phosphoglycoprotein that interacts with <t>IFITM2/3,</t> related to Fig. 5 . (A) The MYCT1 protein is highly conserved across vertebrates. An alignment of human MYCT1 protein sequence with those of the indicated species, amino acid conservation is color-coded as indicated in the legend below. Percentages next to species indicate amino acid sequence identity (left) and homology (right) in comparison with human sequence. (B) Short MYCT1 isoform is predominant in ECs. Cells were transduced with Ad- GFP (control) or Ad- MYCT1 (187-aa isoform with C-terminal V5 tag) adenoviruses. Western blot analysis for the indicated proteins. (C) Workflow for mass spectrometry experiments. MYCT1-negative SW480 colon cancer cells were used to exclude nonspecific interactors pulled down by MYCT1 IgG. n = 2 independent experiments. (D) Venn diagram showing how the short list of MYCT1 interactors was selected. (E) Interaction between MYCT1 and IFITM2/3 was analyzed by PLA in ECs. siRNA-mediated knockdown of either protein confirmed specificity of PLA signal. Staining of ECs for PLA dots (gray), VE-cadherin (magenta), and DNA (blue). Scale bar, 50 µm. (F) Quantification of the number of PLA dots per cell in control, MYCT1 KD , and IFITM2/3 KD cells. n = 3 independent experiments; 500–1,500 cells were analyzed per condition for each experiment; mean ± SD; one-way ANOVA with Dunnett’s multiple comparisons, P = 0.036 (*) for MYCT1 knockdown effect. (G) Positive control (VE-cadherin::β-catenin) and negative control (MYCT1 antibody alone) for PLA signal in human brain sections. PLA dots (gray) and staining of ECs for VE-cadherin or Pecam1 (magenta) and DNA (blue). Arrowhead, colocalization of PLA dots with vascular marker. Scale bar, 20 µm. Source data are available for this figure: .
Sensifast 2 Sybr Lorox Kit, supplied by Meridian Bioscience, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ifitm2+human+reverse/pm34319159-296-36-41?v=Meridian+Bioscience
Average 90 stars, based on 1 article reviews
sensifast 2 sybr lorox kit - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
Meridian Bioscience sensifast cdna synthesis kit
MYCT1 is a transmembrane phosphoglycoprotein that interacts with <t>IFITM2/3,</t> related to Fig. 5 . (A) The MYCT1 protein is highly conserved across vertebrates. An alignment of human MYCT1 protein sequence with those of the indicated species, amino acid conservation is color-coded as indicated in the legend below. Percentages next to species indicate amino acid sequence identity (left) and homology (right) in comparison with human sequence. (B) Short MYCT1 isoform is predominant in ECs. Cells were transduced with Ad- GFP (control) or Ad- MYCT1 (187-aa isoform with C-terminal V5 tag) adenoviruses. Western blot analysis for the indicated proteins. (C) Workflow for mass spectrometry experiments. MYCT1-negative SW480 colon cancer cells were used to exclude nonspecific interactors pulled down by MYCT1 IgG. n = 2 independent experiments. (D) Venn diagram showing how the short list of MYCT1 interactors was selected. (E) Interaction between MYCT1 and IFITM2/3 was analyzed by PLA in ECs. siRNA-mediated knockdown of either protein confirmed specificity of PLA signal. Staining of ECs for PLA dots (gray), VE-cadherin (magenta), and DNA (blue). Scale bar, 50 µm. (F) Quantification of the number of PLA dots per cell in control, MYCT1 KD , and IFITM2/3 KD cells. n = 3 independent experiments; 500–1,500 cells were analyzed per condition for each experiment; mean ± SD; one-way ANOVA with Dunnett’s multiple comparisons, P = 0.036 (*) for MYCT1 knockdown effect. (G) Positive control (VE-cadherin::β-catenin) and negative control (MYCT1 antibody alone) for PLA signal in human brain sections. PLA dots (gray) and staining of ECs for VE-cadherin or Pecam1 (magenta) and DNA (blue). Arrowhead, colocalization of PLA dots with vascular marker. Scale bar, 20 µm. Source data are available for this figure: .
Sensifast Cdna Synthesis Kit, supplied by Meridian Bioscience, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ifitm2+human+reverse/pm34319159-296-24-28?v=Meridian+Bioscience
Average 90 stars, based on 1 article reviews
sensifast cdna synthesis kit - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

99
Qiagen rneasy plus mini kit
MYCT1 is a transmembrane phosphoglycoprotein that interacts with <t>IFITM2/3,</t> related to Fig. 5 . (A) The MYCT1 protein is highly conserved across vertebrates. An alignment of human MYCT1 protein sequence with those of the indicated species, amino acid conservation is color-coded as indicated in the legend below. Percentages next to species indicate amino acid sequence identity (left) and homology (right) in comparison with human sequence. (B) Short MYCT1 isoform is predominant in ECs. Cells were transduced with Ad- GFP (control) or Ad- MYCT1 (187-aa isoform with C-terminal V5 tag) adenoviruses. Western blot analysis for the indicated proteins. (C) Workflow for mass spectrometry experiments. MYCT1-negative SW480 colon cancer cells were used to exclude nonspecific interactors pulled down by MYCT1 IgG. n = 2 independent experiments. (D) Venn diagram showing how the short list of MYCT1 interactors was selected. (E) Interaction between MYCT1 and IFITM2/3 was analyzed by PLA in ECs. siRNA-mediated knockdown of either protein confirmed specificity of PLA signal. Staining of ECs for PLA dots (gray), VE-cadherin (magenta), and DNA (blue). Scale bar, 50 µm. (F) Quantification of the number of PLA dots per cell in control, MYCT1 KD , and IFITM2/3 KD cells. n = 3 independent experiments; 500–1,500 cells were analyzed per condition for each experiment; mean ± SD; one-way ANOVA with Dunnett’s multiple comparisons, P = 0.036 (*) for MYCT1 knockdown effect. (G) Positive control (VE-cadherin::β-catenin) and negative control (MYCT1 antibody alone) for PLA signal in human brain sections. PLA dots (gray) and staining of ECs for VE-cadherin or Pecam1 (magenta) and DNA (blue). Arrowhead, colocalization of PLA dots with vascular marker. Scale bar, 20 µm. Source data are available for this figure: .
Rneasy Plus Mini Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ifitm2+human+reverse/pmc10145288-44-9-13?v=Qiagen
Average 99 stars, based on 1 article reviews
rneasy plus mini kit - by Bioz Stars, 2026-07
99/100 stars
  Buy from Supplier

95
Qiagen hiperfect transfection reagent
MYCT1 is a transmembrane phosphoglycoprotein that interacts with <t>IFITM2/3,</t> related to Fig. 5 . (A) The MYCT1 protein is highly conserved across vertebrates. An alignment of human MYCT1 protein sequence with those of the indicated species, amino acid conservation is color-coded as indicated in the legend below. Percentages next to species indicate amino acid sequence identity (left) and homology (right) in comparison with human sequence. (B) Short MYCT1 isoform is predominant in ECs. Cells were transduced with Ad- GFP (control) or Ad- MYCT1 (187-aa isoform with C-terminal V5 tag) adenoviruses. Western blot analysis for the indicated proteins. (C) Workflow for mass spectrometry experiments. MYCT1-negative SW480 colon cancer cells were used to exclude nonspecific interactors pulled down by MYCT1 IgG. n = 2 independent experiments. (D) Venn diagram showing how the short list of MYCT1 interactors was selected. (E) Interaction between MYCT1 and IFITM2/3 was analyzed by PLA in ECs. siRNA-mediated knockdown of either protein confirmed specificity of PLA signal. Staining of ECs for PLA dots (gray), VE-cadherin (magenta), and DNA (blue). Scale bar, 50 µm. (F) Quantification of the number of PLA dots per cell in control, MYCT1 KD , and IFITM2/3 KD cells. n = 3 independent experiments; 500–1,500 cells were analyzed per condition for each experiment; mean ± SD; one-way ANOVA with Dunnett’s multiple comparisons, P = 0.036 (*) for MYCT1 knockdown effect. (G) Positive control (VE-cadherin::β-catenin) and negative control (MYCT1 antibody alone) for PLA signal in human brain sections. PLA dots (gray) and staining of ECs for VE-cadherin or Pecam1 (magenta) and DNA (blue). Arrowhead, colocalization of PLA dots with vascular marker. Scale bar, 20 µm. Source data are available for this figure: .
Hiperfect Transfection Reagent, supplied by Qiagen, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ifitm2+human+reverse/pmc03719792-123-5-8?v=Qiagen
Average 95 stars, based on 1 article reviews
hiperfect transfection reagent - by Bioz Stars, 2026-07
95/100 stars
  Buy from Supplier

99
Abcam ifitm3
Stable IFITM‐positive cell lines were produced in 293T cells, and the expression of each protein was measured by flow cytometry. 293T cells were infected with ZIKV HD78 (MOI 1), and viral replication was measured at days 2 and 3 post‐infection (pi) by flow cytometry using the anti‐E protein antibody 4G2, as illustrated in one representative experiment. Results from four independent experiments as in (B) were quantified at day 3 pi. Mean ± SEM. 293T cells expressing or not <t>IFITM3</t> were infected with the indicated ZIKV strains. Viral replication was measured at day 2 or 3 post‐infection (pi) by flow cytometry using the anti‐E protein antibody 4G2. Results are mean ± SEM of three independent experiments. Human foreskin fibroblasts (HFF) (left panels) or human adult dermal fibroblasts (HDFa) (right panels) overexpressing or not IFITM3 were infected with ZIKV, and the % of E‐positive cells was measured by flow cytometry at day 2 pi. For each cell type, one representative experiment is shown on the left and the mean ± SEM of three independent experiments on the right. Data information: Statistical significance was determined using ANOVA test. *** P < 0.001; ** P < 0.01.
Ifitm3, supplied by Abcam, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ifitm2+human+reverse/pmc05470047-214-11-12?v=Abcam
Average 99 stars, based on 1 article reviews
ifitm3 - by Bioz Stars, 2026-07
99/100 stars
  Buy from Supplier

94
Proteintech immunoblotting mouse anti ifitm1
Stable IFITM‐positive cell lines were produced in 293T cells, and the expression of each protein was measured by flow cytometry. 293T cells were infected with ZIKV HD78 (MOI 1), and viral replication was measured at days 2 and 3 post‐infection (pi) by flow cytometry using the anti‐E protein antibody 4G2, as illustrated in one representative experiment. Results from four independent experiments as in (B) were quantified at day 3 pi. Mean ± SEM. 293T cells expressing or not <t>IFITM3</t> were infected with the indicated ZIKV strains. Viral replication was measured at day 2 or 3 post‐infection (pi) by flow cytometry using the anti‐E protein antibody 4G2. Results are mean ± SEM of three independent experiments. Human foreskin fibroblasts (HFF) (left panels) or human adult dermal fibroblasts (HDFa) (right panels) overexpressing or not IFITM3 were infected with ZIKV, and the % of E‐positive cells was measured by flow cytometry at day 2 pi. For each cell type, one representative experiment is shown on the left and the mean ± SEM of three independent experiments on the right. Data information: Statistical significance was determined using ANOVA test. *** P < 0.001; ** P < 0.01.
Immunoblotting Mouse Anti Ifitm1, supplied by Proteintech, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ifitm2+human+reverse/bio_rxiv__2021__07__23__453596-144-6-9?v=Proteintech
Average 94 stars, based on 1 article reviews
immunoblotting mouse anti ifitm1 - by Bioz Stars, 2026-07
94/100 stars
  Buy from Supplier

Image Search Results


MYCT1 is a transmembrane phosphoglycoprotein that interacts with IFITM2/3, related to Fig. 5 . (A) The MYCT1 protein is highly conserved across vertebrates. An alignment of human MYCT1 protein sequence with those of the indicated species, amino acid conservation is color-coded as indicated in the legend below. Percentages next to species indicate amino acid sequence identity (left) and homology (right) in comparison with human sequence. (B) Short MYCT1 isoform is predominant in ECs. Cells were transduced with Ad- GFP (control) or Ad- MYCT1 (187-aa isoform with C-terminal V5 tag) adenoviruses. Western blot analysis for the indicated proteins. (C) Workflow for mass spectrometry experiments. MYCT1-negative SW480 colon cancer cells were used to exclude nonspecific interactors pulled down by MYCT1 IgG. n = 2 independent experiments. (D) Venn diagram showing how the short list of MYCT1 interactors was selected. (E) Interaction between MYCT1 and IFITM2/3 was analyzed by PLA in ECs. siRNA-mediated knockdown of either protein confirmed specificity of PLA signal. Staining of ECs for PLA dots (gray), VE-cadherin (magenta), and DNA (blue). Scale bar, 50 µm. (F) Quantification of the number of PLA dots per cell in control, MYCT1 KD , and IFITM2/3 KD cells. n = 3 independent experiments; 500–1,500 cells were analyzed per condition for each experiment; mean ± SD; one-way ANOVA with Dunnett’s multiple comparisons, P = 0.036 (*) for MYCT1 knockdown effect. (G) Positive control (VE-cadherin::β-catenin) and negative control (MYCT1 antibody alone) for PLA signal in human brain sections. PLA dots (gray) and staining of ECs for VE-cadherin or Pecam1 (magenta) and DNA (blue). Arrowhead, colocalization of PLA dots with vascular marker. Scale bar, 20 µm. Source data are available for this figure: .

Journal: The Journal of Experimental Medicine

Article Title: MYCT1–IFITM2/3 interaction links endothelial endolysosomal trafficking to white adipose tissue expansion

doi: 10.1084/jem.20251497

Figure Lengend Snippet: MYCT1 is a transmembrane phosphoglycoprotein that interacts with IFITM2/3, related to Fig. 5 . (A) The MYCT1 protein is highly conserved across vertebrates. An alignment of human MYCT1 protein sequence with those of the indicated species, amino acid conservation is color-coded as indicated in the legend below. Percentages next to species indicate amino acid sequence identity (left) and homology (right) in comparison with human sequence. (B) Short MYCT1 isoform is predominant in ECs. Cells were transduced with Ad- GFP (control) or Ad- MYCT1 (187-aa isoform with C-terminal V5 tag) adenoviruses. Western blot analysis for the indicated proteins. (C) Workflow for mass spectrometry experiments. MYCT1-negative SW480 colon cancer cells were used to exclude nonspecific interactors pulled down by MYCT1 IgG. n = 2 independent experiments. (D) Venn diagram showing how the short list of MYCT1 interactors was selected. (E) Interaction between MYCT1 and IFITM2/3 was analyzed by PLA in ECs. siRNA-mediated knockdown of either protein confirmed specificity of PLA signal. Staining of ECs for PLA dots (gray), VE-cadherin (magenta), and DNA (blue). Scale bar, 50 µm. (F) Quantification of the number of PLA dots per cell in control, MYCT1 KD , and IFITM2/3 KD cells. n = 3 independent experiments; 500–1,500 cells were analyzed per condition for each experiment; mean ± SD; one-way ANOVA with Dunnett’s multiple comparisons, P = 0.036 (*) for MYCT1 knockdown effect. (G) Positive control (VE-cadherin::β-catenin) and negative control (MYCT1 antibody alone) for PLA signal in human brain sections. PLA dots (gray) and staining of ECs for VE-cadherin or Pecam1 (magenta) and DNA (blue). Arrowhead, colocalization of PLA dots with vascular marker. Scale bar, 20 µm. Source data are available for this figure: .

Article Snippet: IFITM2 (human) reverse , Eurofins , 5′-CCC CCA GCA TAG CCA CTT CC-3′.

Techniques: Sequencing, Comparison, Transduction, Control, Western Blot, Mass Spectrometry, Knockdown, Staining, Positive Control, Negative Control, Marker

MYCT1 is a transmembrane phosphoglycoprotein that interacts with IFITM2/3. (A) Endogenous MYCT1 is located at cell–cell junctions (arrow) and in puncta (arrowhead). Staining of human primary ECs for MYCT1 (black), VE-cadherin (magenta), and DNA (blue). Scale bar, 10 µm. (B) MYCT1 is a membrane protein. Western blot analysis of various EC fractions for MYCT1, GAPDH, PECAM1, H3K27ac, and vimentin proteins. Cy, cytoplasm; Mb, membrane; Nu, nucleus; Ck, cytoskeleton. (C) MYCT1 is glycosylated. Western blot analysis of MYCT1 protein electrophoretic mobility in control and PNGase-F–treated lysates. (D) Schematic model of MYCT1 structure and domains with phosphorylation sites, identified by mass spectrometry. MYCT1 phosphorylation sites are highly conserved as indicated by the color scale. Asterisks indicate sites also described at https://www.phosphosite.org/ . (E) Top five proteins interacting with MYCT1 as identified by mass spectrometry, among which IFITM2 and IFITM3. ECs were transduced with recombinant adenoviruses to transiently overexpress MYCT1 or GFP, as a control. Cell lysates were collected 48 h after transduction, immunoprecipitated using MYCT1 antibody or a control IgG, and analyzed by mass spectrometry. Proteins interacting with both endogenous and overexpressed MYCT1 were selected and ranked by normalized spectral abundance factor (NSAF) from two independent mass spectrometry (MS) experiments are shown (31 proteins); the top five proteins are highlighted in magenta. (F) GO terms of the cellular component and biological process overrepresented in the MYCT1 interactome. Fisher’s exact test with adjustment for false discovery rate (FDR). (G) Validation of IFITM2/3 and MYCT1 interaction by co-IP. EC lysates from confluent ECs were immunoprecipitated (IP) with MYCT1 or control IgG and blotted for IFITM2/3. H, IgG heavy chain; L, IgG light chain. (H) IFITM2/3 are constitutively expressed in ECs in vitro and in vivo . Staining of human primary ECs (upper panels), human brain and WAT sections (lower panels) for MYCT1 (gray), IFITM2/3 (green), VE-cadherin (magenta), and DNA (blue). Scale bar, 20 µm (brain) and 50 µm (adipose tissue). (I) MYCT1 and IFITM2/3 interact in brain ECs. Proximity ligation assay (PLA) in human brain sections. Detection of PLA dots (gray) in ECs and staining for VE-cadherin (magenta) and DNA (blue). Arrowheads, colocalization of MYCT1::IFITM2/3 PLA dots and VE-cadherin staining. Scale bar, 20 µm. See also . Source data are available for this figure: .

Journal: The Journal of Experimental Medicine

Article Title: MYCT1–IFITM2/3 interaction links endothelial endolysosomal trafficking to white adipose tissue expansion

doi: 10.1084/jem.20251497

Figure Lengend Snippet: MYCT1 is a transmembrane phosphoglycoprotein that interacts with IFITM2/3. (A) Endogenous MYCT1 is located at cell–cell junctions (arrow) and in puncta (arrowhead). Staining of human primary ECs for MYCT1 (black), VE-cadherin (magenta), and DNA (blue). Scale bar, 10 µm. (B) MYCT1 is a membrane protein. Western blot analysis of various EC fractions for MYCT1, GAPDH, PECAM1, H3K27ac, and vimentin proteins. Cy, cytoplasm; Mb, membrane; Nu, nucleus; Ck, cytoskeleton. (C) MYCT1 is glycosylated. Western blot analysis of MYCT1 protein electrophoretic mobility in control and PNGase-F–treated lysates. (D) Schematic model of MYCT1 structure and domains with phosphorylation sites, identified by mass spectrometry. MYCT1 phosphorylation sites are highly conserved as indicated by the color scale. Asterisks indicate sites also described at https://www.phosphosite.org/ . (E) Top five proteins interacting with MYCT1 as identified by mass spectrometry, among which IFITM2 and IFITM3. ECs were transduced with recombinant adenoviruses to transiently overexpress MYCT1 or GFP, as a control. Cell lysates were collected 48 h after transduction, immunoprecipitated using MYCT1 antibody or a control IgG, and analyzed by mass spectrometry. Proteins interacting with both endogenous and overexpressed MYCT1 were selected and ranked by normalized spectral abundance factor (NSAF) from two independent mass spectrometry (MS) experiments are shown (31 proteins); the top five proteins are highlighted in magenta. (F) GO terms of the cellular component and biological process overrepresented in the MYCT1 interactome. Fisher’s exact test with adjustment for false discovery rate (FDR). (G) Validation of IFITM2/3 and MYCT1 interaction by co-IP. EC lysates from confluent ECs were immunoprecipitated (IP) with MYCT1 or control IgG and blotted for IFITM2/3. H, IgG heavy chain; L, IgG light chain. (H) IFITM2/3 are constitutively expressed in ECs in vitro and in vivo . Staining of human primary ECs (upper panels), human brain and WAT sections (lower panels) for MYCT1 (gray), IFITM2/3 (green), VE-cadherin (magenta), and DNA (blue). Scale bar, 20 µm (brain) and 50 µm (adipose tissue). (I) MYCT1 and IFITM2/3 interact in brain ECs. Proximity ligation assay (PLA) in human brain sections. Detection of PLA dots (gray) in ECs and staining for VE-cadherin (magenta) and DNA (blue). Arrowheads, colocalization of MYCT1::IFITM2/3 PLA dots and VE-cadherin staining. Scale bar, 20 µm. See also . Source data are available for this figure: .

Article Snippet: IFITM2 (human) reverse , Eurofins , 5′-CCC CCA GCA TAG CCA CTT CC-3′.

Techniques: Staining, Membrane, Western Blot, Control, Phospho-proteomics, Mass Spectrometry, Transduction, Recombinant, Immunoprecipitation, Biomarker Discovery, Co-Immunoprecipitation Assay, In Vitro, In Vivo, Proximity Ligation Assay

MYCT1 limits enlargement of IFITM2/3 + endosomes. (A) MYCT1 and IFITM2/3 display inverse regulatory dynamics. MYCT1 knockdown increases total IFITM2/3 protein levels, whereas IFITM2/3 knockdown reduces total MYCT1 protein levels. Western blot analysis of confluent ECs 48 h after siRNA transfection for the indicated proteins. Quantification of total MYCT1 and IFITM2/3 protein levels relative to the control is indicated as the average of all experiments under the respective blots. n = 4 independent experiments; one-way ANOVA with Dunnett’s multiple comparisons test; P < 0.0001 (*) for MYCT1 knockdown effect on MYCT1, P = 0.004 (*) for IFITM2/3 knockdown effect on MYCT1, P = 0.015 (*) for MYCT1 knockdown effect on IFITM2/3, and P = 0.0016 (*) for IFITM2/3 knockdown effect on IFITM2/3. (B) MYCT1 knockdown increases IFITM2/3 + vesicle volume. Staining of ECs for MYCT1 (gray), IFITM2/3 (green), VE-cadherin (magenta), and DNA (blue). Yellow box: magnification of IFITM2/3 from highlighted areas, shown below. Scale bar, 20 µm. (C) Quantification of the IFITM2/3 + vesicle volume in control and MYCT1 KD cells. n = 4 independent experiments; 500–1,500 vesicles from 15 to 20 cells were analyzed per condition for each experiment; mean ± SD; unpaired t test; P = 0.039 (*). (D) IFITM2/3 localize mainly to the RAB5 + early endosome in ECs, rather than to RAB7 + late endosome and LAMP1 + lysosome. Staining for IFITM2/3 (gray), RAB5 or RAB7 or LAMP1 (green), and DNA (blue). Yellow box: magnification of IFITM2/3 and endolysosomal markers from highlighted areas, shown below. Yellow arrows, IFITM2/3 + RAB5 + vesicles; magenta arrows, IFITM2/3 + RAB7 neg or IFITM2/3 + LAMP1 neg vesicles. Scale bar, 20 µm. (E) Quantification of colocalization of IFITM2/3 with RAB5, RAB7, and LAMP1 by Manders’ overlap coefficients. n = 2–4 independent experiments; 15–25 cells were analyzed per condition for each experiment; mean ± SD; two-way ANOVA with Tukey’s multiple comparisons test, P < 0.001 (*) for both RAB5 versus RAB7 and RAB5 versus LAMP1. (F) MYCT1 knockdown causes enlargement of RAB5 + early endosomes. Staining of ECs for RAB5 (gray/black), VE-cadherin (magenta), and DAPI (blue). Cyan box: magnification of RAB5 from highlighted areas, shown below. Scale bar, 10 μm. (G) Quantification of RAB5 + vesicle volume. n = 4 independent experiments; 400–800 vesicles were analyzed per condition for each experiment; mean ± SD; unpaired t test, P = 0.0133 (*). (H) Myct1 ablation enlarges Rab5 + early endosomes in aortic ECs. En face staining of aorta from wild-type or Myct1 ecKO mice for Rab5 (gray/black) and VE-cadherin (magenta). Cyan box: magnification of RAB5 from highlighted areas, shown below. Scale bar, 5 μm. (I) Quantification of Rab5 + vesicle volume in aortic ECs. n = 5 mice per genotype; 1,000–4,000 vesicles were analyzed per mouse; mean ± SD; unpaired t test, P = 0.0128 (*). (J) MYCT1 depletion leads to IFITM2/3 + early endosome enlargement. Icons used in J were created with BioRender.com and modified in Affinity. See also . Source data are available for this figure: .

Journal: The Journal of Experimental Medicine

Article Title: MYCT1–IFITM2/3 interaction links endothelial endolysosomal trafficking to white adipose tissue expansion

doi: 10.1084/jem.20251497

Figure Lengend Snippet: MYCT1 limits enlargement of IFITM2/3 + endosomes. (A) MYCT1 and IFITM2/3 display inverse regulatory dynamics. MYCT1 knockdown increases total IFITM2/3 protein levels, whereas IFITM2/3 knockdown reduces total MYCT1 protein levels. Western blot analysis of confluent ECs 48 h after siRNA transfection for the indicated proteins. Quantification of total MYCT1 and IFITM2/3 protein levels relative to the control is indicated as the average of all experiments under the respective blots. n = 4 independent experiments; one-way ANOVA with Dunnett’s multiple comparisons test; P < 0.0001 (*) for MYCT1 knockdown effect on MYCT1, P = 0.004 (*) for IFITM2/3 knockdown effect on MYCT1, P = 0.015 (*) for MYCT1 knockdown effect on IFITM2/3, and P = 0.0016 (*) for IFITM2/3 knockdown effect on IFITM2/3. (B) MYCT1 knockdown increases IFITM2/3 + vesicle volume. Staining of ECs for MYCT1 (gray), IFITM2/3 (green), VE-cadherin (magenta), and DNA (blue). Yellow box: magnification of IFITM2/3 from highlighted areas, shown below. Scale bar, 20 µm. (C) Quantification of the IFITM2/3 + vesicle volume in control and MYCT1 KD cells. n = 4 independent experiments; 500–1,500 vesicles from 15 to 20 cells were analyzed per condition for each experiment; mean ± SD; unpaired t test; P = 0.039 (*). (D) IFITM2/3 localize mainly to the RAB5 + early endosome in ECs, rather than to RAB7 + late endosome and LAMP1 + lysosome. Staining for IFITM2/3 (gray), RAB5 or RAB7 or LAMP1 (green), and DNA (blue). Yellow box: magnification of IFITM2/3 and endolysosomal markers from highlighted areas, shown below. Yellow arrows, IFITM2/3 + RAB5 + vesicles; magenta arrows, IFITM2/3 + RAB7 neg or IFITM2/3 + LAMP1 neg vesicles. Scale bar, 20 µm. (E) Quantification of colocalization of IFITM2/3 with RAB5, RAB7, and LAMP1 by Manders’ overlap coefficients. n = 2–4 independent experiments; 15–25 cells were analyzed per condition for each experiment; mean ± SD; two-way ANOVA with Tukey’s multiple comparisons test, P < 0.001 (*) for both RAB5 versus RAB7 and RAB5 versus LAMP1. (F) MYCT1 knockdown causes enlargement of RAB5 + early endosomes. Staining of ECs for RAB5 (gray/black), VE-cadherin (magenta), and DAPI (blue). Cyan box: magnification of RAB5 from highlighted areas, shown below. Scale bar, 10 μm. (G) Quantification of RAB5 + vesicle volume. n = 4 independent experiments; 400–800 vesicles were analyzed per condition for each experiment; mean ± SD; unpaired t test, P = 0.0133 (*). (H) Myct1 ablation enlarges Rab5 + early endosomes in aortic ECs. En face staining of aorta from wild-type or Myct1 ecKO mice for Rab5 (gray/black) and VE-cadherin (magenta). Cyan box: magnification of RAB5 from highlighted areas, shown below. Scale bar, 5 μm. (I) Quantification of Rab5 + vesicle volume in aortic ECs. n = 5 mice per genotype; 1,000–4,000 vesicles were analyzed per mouse; mean ± SD; unpaired t test, P = 0.0128 (*). (J) MYCT1 depletion leads to IFITM2/3 + early endosome enlargement. Icons used in J were created with BioRender.com and modified in Affinity. See also . Source data are available for this figure: .

Article Snippet: IFITM2 (human) reverse , Eurofins , 5′-CCC CCA GCA TAG CCA CTT CC-3′.

Techniques: Knockdown, Western Blot, Transfection, Control, Staining, Modification

MYCT1 restricts endothelial endocytosis and IFITM2/3-dependent mTORC1 activation, related to Figs. 6 and 7. (A) IFITM2/3 antibody and siRNA validation for identification of endogenous human IFITM2/3 proteins. IFITM2/3 knockdown reduces MYCT1 protein levels. Staining of ECs for MYCT1 (gray), IFITM2/3 (green), and DNA (blue). Scale bar, 20 µm. (B) Quantification of MYCT1 protein levels in control and IFITM2/3 KD cells. n = 4 independent experiments; mean ± SD; Welch’s t test, P = 0.0014 (*). (C and D) MYCT1 knockdown does not affect IFITM2 (C) nor IFITM3 (D) mRNA levels in ECs. n = 3 independent experiments; mean ± SD; Welch’s t test, P > 0.05. (E) MYCT1 knockdown does not impact RAB7 + late endosomes nor LAMP1 + endolysosomes. Staining of ECs for RAB7 (gray), LAMP1 (green), VE-cadherin (magenta), and DNA (blue). Scale bar, 20 µm. (F and G) Quantification of RAB7 + (F) and LAMP1 + (G) areas per cell in control and MYCT1 KD cells. n = 3 independent experiments; 20–50 cells were analyzed per condition for each experiment; mean ± SD; Welch’s t test, P > 0.05. (H) MYCT1 knockdown increased FITC-dextran uptake. 2 days after siRNA transfection, cells were starved for 1 h in PBS, followed by a 30-min induction with amino acid solution together with 10-kDa FITC dextran. Detection of 10-kDa FITC-dextran (gray) and staining of ECs for VE-cadherin (magenta) and DAPI (blue). Arrow, dextran + puncta. Scale bar, 10 μm. (I) Quantification of the number of dextran + puncta per cell in control and MYCT1 KD cells. n = 3 independent experiments; 30–50 cells were analyzed per condition for each experiment; mean ± SD; Welch’s t test, P = 0.0016 (*). (J) Example of gating strategy (7-AAD neg CD45 neg CD31 + ) of ECs from gonadal fat pad by flow cytometry. (K) WAT ECs take up higher amounts of labeled plasma proteins compared with colon ECs. Quantification of labeled plasma protein uptake in ECs from s.c. and visceral WAT and colon normalized to plasma Atto-647 signal. n = 10 mice per organ; Friedman test with Dunn’s multiple comparisons test, P > 0.05 for scFAT versus visFAT, P = 0.0052 for scFAT versus colon, and P = 0.001 (*) for visFAT versus colon. (L) Endocytosis inhibition with dynasore rescues mTORC1 hyperactivation caused by knockdown of MYCT1 . Staining for p-S6 (gray), β-catenin (magenta), and DAPI (blue). Scale bar, 50 μm. (M) Quantification of mTORC1 activation by amino acid supplementation in control and MYCT1 KD cells in the absence or presence of dynasore. The percentage of p-S6 + cells was quantified in the indicated conditions. n = 3 independent experiments; 1,500–6,000 cells were analyzed per condition for each experiment; mean ± SD; two-way ANOVA with Tukey’s multiple comparisons test, P = 0.004 (*) for MYCT1 knockdown effect in control conditions and P < 0.001 (*) for its rescue by dynasore treatment. (N) RAB5 knockdown rescues mTORC1 hyperactivation in MYCT1 KD cells. Staining of ECs for p-S6 (gray), β-catenin (magenta), and DAPI (blue). Scale bar, 50 μm. (O) Quantification of mTORC1 activation in control, MYCT1 KD , and MYCT1-RAB5 KD cells. The percentage of p-S6 + cells was quantified in the indicated conditions. n = 3 independent experiments; 7,000-15,000 cells were analyzed per condition for each experiment; mean ± SD; one-way ANOVA with Tukey’s multiple comparisons test, P = 0.0021 (*) for MYCT1 knockdown effect and P = 0.0292 (*) for its rescue by RAB5 double knockdown. (P) IFITM2/3 knockdown rescues mTORC1 hyperactivation in MYCT1 -deficient human adipose ECs. Staining for p-S6 (gray), β-catenin (magenta), and DAPI (blue). Scale bar, 100 μm. (Q) Quantification of mTORC1 activation in control, MYCT1 KD , IFITM2/3 KD , and MYCT1 – IFITM2/3 KD cells. The percentage of p-S6 + cells was quantified in the indicated conditions. n = 2 independent experiments; 1,500–3,000 cells were analyzed per condition for each experiment; mean ± SD; one-way ANOVA with Tukey’s multiple comparisons test, P = 0.0168 (*) for MYCT1 knockdown effect and P = 0.0123 (*) for rescue effect by IFITM2/3 double knockdown.

Journal: The Journal of Experimental Medicine

Article Title: MYCT1–IFITM2/3 interaction links endothelial endolysosomal trafficking to white adipose tissue expansion

doi: 10.1084/jem.20251497

Figure Lengend Snippet: MYCT1 restricts endothelial endocytosis and IFITM2/3-dependent mTORC1 activation, related to Figs. 6 and 7. (A) IFITM2/3 antibody and siRNA validation for identification of endogenous human IFITM2/3 proteins. IFITM2/3 knockdown reduces MYCT1 protein levels. Staining of ECs for MYCT1 (gray), IFITM2/3 (green), and DNA (blue). Scale bar, 20 µm. (B) Quantification of MYCT1 protein levels in control and IFITM2/3 KD cells. n = 4 independent experiments; mean ± SD; Welch’s t test, P = 0.0014 (*). (C and D) MYCT1 knockdown does not affect IFITM2 (C) nor IFITM3 (D) mRNA levels in ECs. n = 3 independent experiments; mean ± SD; Welch’s t test, P > 0.05. (E) MYCT1 knockdown does not impact RAB7 + late endosomes nor LAMP1 + endolysosomes. Staining of ECs for RAB7 (gray), LAMP1 (green), VE-cadherin (magenta), and DNA (blue). Scale bar, 20 µm. (F and G) Quantification of RAB7 + (F) and LAMP1 + (G) areas per cell in control and MYCT1 KD cells. n = 3 independent experiments; 20–50 cells were analyzed per condition for each experiment; mean ± SD; Welch’s t test, P > 0.05. (H) MYCT1 knockdown increased FITC-dextran uptake. 2 days after siRNA transfection, cells were starved for 1 h in PBS, followed by a 30-min induction with amino acid solution together with 10-kDa FITC dextran. Detection of 10-kDa FITC-dextran (gray) and staining of ECs for VE-cadherin (magenta) and DAPI (blue). Arrow, dextran + puncta. Scale bar, 10 μm. (I) Quantification of the number of dextran + puncta per cell in control and MYCT1 KD cells. n = 3 independent experiments; 30–50 cells were analyzed per condition for each experiment; mean ± SD; Welch’s t test, P = 0.0016 (*). (J) Example of gating strategy (7-AAD neg CD45 neg CD31 + ) of ECs from gonadal fat pad by flow cytometry. (K) WAT ECs take up higher amounts of labeled plasma proteins compared with colon ECs. Quantification of labeled plasma protein uptake in ECs from s.c. and visceral WAT and colon normalized to plasma Atto-647 signal. n = 10 mice per organ; Friedman test with Dunn’s multiple comparisons test, P > 0.05 for scFAT versus visFAT, P = 0.0052 for scFAT versus colon, and P = 0.001 (*) for visFAT versus colon. (L) Endocytosis inhibition with dynasore rescues mTORC1 hyperactivation caused by knockdown of MYCT1 . Staining for p-S6 (gray), β-catenin (magenta), and DAPI (blue). Scale bar, 50 μm. (M) Quantification of mTORC1 activation by amino acid supplementation in control and MYCT1 KD cells in the absence or presence of dynasore. The percentage of p-S6 + cells was quantified in the indicated conditions. n = 3 independent experiments; 1,500–6,000 cells were analyzed per condition for each experiment; mean ± SD; two-way ANOVA with Tukey’s multiple comparisons test, P = 0.004 (*) for MYCT1 knockdown effect in control conditions and P < 0.001 (*) for its rescue by dynasore treatment. (N) RAB5 knockdown rescues mTORC1 hyperactivation in MYCT1 KD cells. Staining of ECs for p-S6 (gray), β-catenin (magenta), and DAPI (blue). Scale bar, 50 μm. (O) Quantification of mTORC1 activation in control, MYCT1 KD , and MYCT1-RAB5 KD cells. The percentage of p-S6 + cells was quantified in the indicated conditions. n = 3 independent experiments; 7,000-15,000 cells were analyzed per condition for each experiment; mean ± SD; one-way ANOVA with Tukey’s multiple comparisons test, P = 0.0021 (*) for MYCT1 knockdown effect and P = 0.0292 (*) for its rescue by RAB5 double knockdown. (P) IFITM2/3 knockdown rescues mTORC1 hyperactivation in MYCT1 -deficient human adipose ECs. Staining for p-S6 (gray), β-catenin (magenta), and DAPI (blue). Scale bar, 100 μm. (Q) Quantification of mTORC1 activation in control, MYCT1 KD , IFITM2/3 KD , and MYCT1 – IFITM2/3 KD cells. The percentage of p-S6 + cells was quantified in the indicated conditions. n = 2 independent experiments; 1,500–3,000 cells were analyzed per condition for each experiment; mean ± SD; one-way ANOVA with Tukey’s multiple comparisons test, P = 0.0168 (*) for MYCT1 knockdown effect and P = 0.0123 (*) for rescue effect by IFITM2/3 double knockdown.

Article Snippet: IFITM2 (human) reverse , Eurofins , 5′-CCC CCA GCA TAG CCA CTT CC-3′.

Techniques: Activation Assay, Biomarker Discovery, Knockdown, Staining, Control, Transfection, Flow Cytometry, Labeling, Clinical Proteomics, Inhibition

MYCT1 restricts endothelial endocytosis and IFITM2/3-dependent mTORC1 activation. (A) Experimental workflow for in vivo Atto647–labeled plasma protein uptake experiment. (B) WAT ECs take up higher amounts of labeled plasma proteins compared with colon ECs. Representative flow cytometry histograms showing Atto647-MFI in ECs from s.c. (sc. fat), visceral (vis. fat) WAT, and colon of two wild-type mice, comparing an injected one (colored) and a non-injected control (gray). (C) Myct1 ablation increases labeled plasma protein uptake in WAT ECs. Atto647-MFI of ECs from visceral WAT of control mice or Myct1 ecKO mice, plotted as a function of corresponding plasma Atto647-fluorescence levels. Each dot corresponds to an individual mouse. Linear regression showing the 95% confidence bands of the best-fit line and the goodness of fit (R 2 ). a.u., arbitrary units, MFI, mean fluorescence intensity. Similar results were obtained for s.c. fat (data not shown). (D) MYCT1 knockdown promotes lysosomal degradation activity. Control and MYCT1 KD cells were treated for 1 h with DQ-BSA. DQ-BSA fluorescence (gray/black) and staining for β-catenin (magenta) and DNA (blue). Lower panels show DQ-BSA. Scale bar, 20 µm. (E) Quantification of the percentage of DQ-BSA signal per cell. n = 4 independent experiments; 60–100 cells were analyzed per condition for each experiment; mean ± SD; unpaired t test, P = 0.0059 (*). (F) IFITM2/3 knockdown rescues RAB5 + endosome enlargement in MYCT1 -deficient ECs. Staining of ECs for RAB5 (gray/black), VE-cadherin (magenta), and DAPI (blue). Lower panels show RAB5. Scale bar, 10 μm. (G) Quantification of RAB5 + vesicle volume in control, MYCT1 KD , IFITM2/3 KD , and MYCT1 – IFITM2/3 KD cells. n = 3 independent experiments; 1,000–3,000 vesicles were analyzed per condition for each experiment; mean ± SD; one-way ANOVA with Tukey’s multiple comparisons test, P = 0.028 (*) for MYCT1 knockdown effect, P = 0.0060 (*) for comparison between MYCT1 and IFITM2/3 knockdowns, and P = 0.0070 (*) for rescue effect by IFITM2/3 simultaneous knockdown. (H) IFITM2/3 knockdown rescues mTORC1 hyperactivation in MYCT1 -deficient ECs. Staining for p-S6 (gray), β-catenin (magenta), and DAPI (blue). Scale bar, 20 μm. (I) Quantification of mTORC1 activation in control, MYCT1 KD , IFITM2/3 KD , and MYCT1 – IFITM2/3 KD cells. The percentage of p-S6 + cells was quantified in the indicated conditions. n = 4 independent experiments; 1,500–8,000 cells were analyzed per condition for each experiment; mean ± SD; one-way ANOVA with Tukey’s multiple comparisons test, P = 0.0195 (*) for MYCT1 knockdown effect and P = 0.0118 (*) for rescue effect by IFITM2/3 simultaneous knockdown. (J) MYCT1 ablation leads to accumulation of IFITM2/3, which drives enlargement of early endosomes, increases cargo uptake, and enhances lysosomal degradation. This process results in greater amino acid delivery, thereby activating mTORC1. These phenotypes are reversed upon simultaneous knockdown of IFITM2/3 and MYCT1 . Icons used in A and J were created with BioRender.com and modified in Affinity. See also .

Journal: The Journal of Experimental Medicine

Article Title: MYCT1–IFITM2/3 interaction links endothelial endolysosomal trafficking to white adipose tissue expansion

doi: 10.1084/jem.20251497

Figure Lengend Snippet: MYCT1 restricts endothelial endocytosis and IFITM2/3-dependent mTORC1 activation. (A) Experimental workflow for in vivo Atto647–labeled plasma protein uptake experiment. (B) WAT ECs take up higher amounts of labeled plasma proteins compared with colon ECs. Representative flow cytometry histograms showing Atto647-MFI in ECs from s.c. (sc. fat), visceral (vis. fat) WAT, and colon of two wild-type mice, comparing an injected one (colored) and a non-injected control (gray). (C) Myct1 ablation increases labeled plasma protein uptake in WAT ECs. Atto647-MFI of ECs from visceral WAT of control mice or Myct1 ecKO mice, plotted as a function of corresponding plasma Atto647-fluorescence levels. Each dot corresponds to an individual mouse. Linear regression showing the 95% confidence bands of the best-fit line and the goodness of fit (R 2 ). a.u., arbitrary units, MFI, mean fluorescence intensity. Similar results were obtained for s.c. fat (data not shown). (D) MYCT1 knockdown promotes lysosomal degradation activity. Control and MYCT1 KD cells were treated for 1 h with DQ-BSA. DQ-BSA fluorescence (gray/black) and staining for β-catenin (magenta) and DNA (blue). Lower panels show DQ-BSA. Scale bar, 20 µm. (E) Quantification of the percentage of DQ-BSA signal per cell. n = 4 independent experiments; 60–100 cells were analyzed per condition for each experiment; mean ± SD; unpaired t test, P = 0.0059 (*). (F) IFITM2/3 knockdown rescues RAB5 + endosome enlargement in MYCT1 -deficient ECs. Staining of ECs for RAB5 (gray/black), VE-cadherin (magenta), and DAPI (blue). Lower panels show RAB5. Scale bar, 10 μm. (G) Quantification of RAB5 + vesicle volume in control, MYCT1 KD , IFITM2/3 KD , and MYCT1 – IFITM2/3 KD cells. n = 3 independent experiments; 1,000–3,000 vesicles were analyzed per condition for each experiment; mean ± SD; one-way ANOVA with Tukey’s multiple comparisons test, P = 0.028 (*) for MYCT1 knockdown effect, P = 0.0060 (*) for comparison between MYCT1 and IFITM2/3 knockdowns, and P = 0.0070 (*) for rescue effect by IFITM2/3 simultaneous knockdown. (H) IFITM2/3 knockdown rescues mTORC1 hyperactivation in MYCT1 -deficient ECs. Staining for p-S6 (gray), β-catenin (magenta), and DAPI (blue). Scale bar, 20 μm. (I) Quantification of mTORC1 activation in control, MYCT1 KD , IFITM2/3 KD , and MYCT1 – IFITM2/3 KD cells. The percentage of p-S6 + cells was quantified in the indicated conditions. n = 4 independent experiments; 1,500–8,000 cells were analyzed per condition for each experiment; mean ± SD; one-way ANOVA with Tukey’s multiple comparisons test, P = 0.0195 (*) for MYCT1 knockdown effect and P = 0.0118 (*) for rescue effect by IFITM2/3 simultaneous knockdown. (J) MYCT1 ablation leads to accumulation of IFITM2/3, which drives enlargement of early endosomes, increases cargo uptake, and enhances lysosomal degradation. This process results in greater amino acid delivery, thereby activating mTORC1. These phenotypes are reversed upon simultaneous knockdown of IFITM2/3 and MYCT1 . Icons used in A and J were created with BioRender.com and modified in Affinity. See also .

Article Snippet: IFITM2 (human) reverse , Eurofins , 5′-CCC CCA GCA TAG CCA CTT CC-3′.

Techniques: Activation Assay, In Vivo, Labeling, Clinical Proteomics, Flow Cytometry, Injection, Control, Fluorescence, Knockdown, Activity Assay, Staining, Comparison, Modification

Endothelial-specific activation of mTORC1 signaling recapitulates adipose tissue phenotype of Myct1 ecKO mice. (A) Tsc1 ecKO mouse model. See Materials and methods for details. (B) Endothelial Tsc1 ablation activates sustained mTORC1 signaling in vivo . En face staining of aorta for p-S6 (gray) and VE-cadherin (magenta). Scale bar, 50 μm. (C) Quantification of mTORC1 activation in the aortic endothelium of wild-type and Tsc1 ecKO mice. The percentage of p-S6 + cells was quantified in n = 5 mice per genotype and conditions; 300–500 cells were analyzed per aorta; mean ± SD; Welch’s t test, P = 0.0121 (*). (D) Workflow of Tsc1 ecKO mouse analysis. (E) Wild-type and Tsc1 ecKO mice were analyzed before significant difference in body weight. Quantification of body weight at the start and end of experiment. n = 10–12 mice per genotype; mean ± SD; multiple unpaired t tests, P > 0.05 at start, P = 0.116 at end. (F) Quantification of fat pad weight to body weight ratio relative to wild-type mice. n = 9 mice per genotype; mean ± SD; multiple unpaired t tests, P = 0.001 (*) for interscapular WAT (IsWAT), P = 0.027 for interscapular BAT (IsBAT), P < 0.001 (*) for inguinal (Ing), P < 0.001 (*) for retroperitoneal (RP), P < 0.001 (*) for gonadal (Gon), and P < 0.001 (*) for mesenteric (Mes). (G) Tsc1 ablation reduces size of adipocytes. Retroperitoneal thick sections stained for Laminin α4 (gray) and Pecam1 (magenta). Scale bar, 50 μm. (H) Quantification of adipocyte size in wild-type and Tsc1 ecKO fat. n = 5 mice per genotype; mean ± SD; unpaired t test, P = 0.0056 (*). (I) Schematic view of the role of endothelial MYCT1–IFITM2/3 complexes in WAT homeostasis. MYCT1 interacts with IFITM2/3, limiting their function and allowing nutrient transport for energy storage. In the absence of MYCT1, IFITM2/3 accumulate in early endosomes and trigger continuous endolysosomal cargo degradation and hyperactivation of mTORC1 signaling in ECs, restricting energy storage in WAT. Icons used in A, D, and I were created with BioRender.com and modified in Affinity.

Journal: The Journal of Experimental Medicine

Article Title: MYCT1–IFITM2/3 interaction links endothelial endolysosomal trafficking to white adipose tissue expansion

doi: 10.1084/jem.20251497

Figure Lengend Snippet: Endothelial-specific activation of mTORC1 signaling recapitulates adipose tissue phenotype of Myct1 ecKO mice. (A) Tsc1 ecKO mouse model. See Materials and methods for details. (B) Endothelial Tsc1 ablation activates sustained mTORC1 signaling in vivo . En face staining of aorta for p-S6 (gray) and VE-cadherin (magenta). Scale bar, 50 μm. (C) Quantification of mTORC1 activation in the aortic endothelium of wild-type and Tsc1 ecKO mice. The percentage of p-S6 + cells was quantified in n = 5 mice per genotype and conditions; 300–500 cells were analyzed per aorta; mean ± SD; Welch’s t test, P = 0.0121 (*). (D) Workflow of Tsc1 ecKO mouse analysis. (E) Wild-type and Tsc1 ecKO mice were analyzed before significant difference in body weight. Quantification of body weight at the start and end of experiment. n = 10–12 mice per genotype; mean ± SD; multiple unpaired t tests, P > 0.05 at start, P = 0.116 at end. (F) Quantification of fat pad weight to body weight ratio relative to wild-type mice. n = 9 mice per genotype; mean ± SD; multiple unpaired t tests, P = 0.001 (*) for interscapular WAT (IsWAT), P = 0.027 for interscapular BAT (IsBAT), P < 0.001 (*) for inguinal (Ing), P < 0.001 (*) for retroperitoneal (RP), P < 0.001 (*) for gonadal (Gon), and P < 0.001 (*) for mesenteric (Mes). (G) Tsc1 ablation reduces size of adipocytes. Retroperitoneal thick sections stained for Laminin α4 (gray) and Pecam1 (magenta). Scale bar, 50 μm. (H) Quantification of adipocyte size in wild-type and Tsc1 ecKO fat. n = 5 mice per genotype; mean ± SD; unpaired t test, P = 0.0056 (*). (I) Schematic view of the role of endothelial MYCT1–IFITM2/3 complexes in WAT homeostasis. MYCT1 interacts with IFITM2/3, limiting their function and allowing nutrient transport for energy storage. In the absence of MYCT1, IFITM2/3 accumulate in early endosomes and trigger continuous endolysosomal cargo degradation and hyperactivation of mTORC1 signaling in ECs, restricting energy storage in WAT. Icons used in A, D, and I were created with BioRender.com and modified in Affinity.

Article Snippet: IFITM2 (human) reverse , Eurofins , 5′-CCC CCA GCA TAG CCA CTT CC-3′.

Techniques: Activation Assay, In Vivo, Staining, Modification

Stable IFITM‐positive cell lines were produced in 293T cells, and the expression of each protein was measured by flow cytometry. 293T cells were infected with ZIKV HD78 (MOI 1), and viral replication was measured at days 2 and 3 post‐infection (pi) by flow cytometry using the anti‐E protein antibody 4G2, as illustrated in one representative experiment. Results from four independent experiments as in (B) were quantified at day 3 pi. Mean ± SEM. 293T cells expressing or not IFITM3 were infected with the indicated ZIKV strains. Viral replication was measured at day 2 or 3 post‐infection (pi) by flow cytometry using the anti‐E protein antibody 4G2. Results are mean ± SEM of three independent experiments. Human foreskin fibroblasts (HFF) (left panels) or human adult dermal fibroblasts (HDFa) (right panels) overexpressing or not IFITM3 were infected with ZIKV, and the % of E‐positive cells was measured by flow cytometry at day 2 pi. For each cell type, one representative experiment is shown on the left and the mean ± SEM of three independent experiments on the right. Data information: Statistical significance was determined using ANOVA test. *** P < 0.001; ** P < 0.01.

Journal: The EMBO Journal

Article Title: Zika virus induces massive cytoplasmic vacuolization and paraptosis‐like death in infected cells

doi: 10.15252/embj.201695597

Figure Lengend Snippet: Stable IFITM‐positive cell lines were produced in 293T cells, and the expression of each protein was measured by flow cytometry. 293T cells were infected with ZIKV HD78 (MOI 1), and viral replication was measured at days 2 and 3 post‐infection (pi) by flow cytometry using the anti‐E protein antibody 4G2, as illustrated in one representative experiment. Results from four independent experiments as in (B) were quantified at day 3 pi. Mean ± SEM. 293T cells expressing or not IFITM3 were infected with the indicated ZIKV strains. Viral replication was measured at day 2 or 3 post‐infection (pi) by flow cytometry using the anti‐E protein antibody 4G2. Results are mean ± SEM of three independent experiments. Human foreskin fibroblasts (HFF) (left panels) or human adult dermal fibroblasts (HDFa) (right panels) overexpressing or not IFITM3 were infected with ZIKV, and the % of E‐positive cells was measured by flow cytometry at day 2 pi. For each cell type, one representative experiment is shown on the left and the mean ± SEM of three independent experiments on the right. Data information: Statistical significance was determined using ANOVA test. *** P < 0.001; ** P < 0.01.

Article Snippet: The following antibodies were used: IFITM1 (Proteintech, 60074‐1‐Ig), IFITM2 (Proteintech, 66137‐1‐Ig), IFITM3 (Abcam, EPR5242/ab109429), actin (Santa Cruz Biotechnology), tubulin (Santa Cruz Biotechnology), and LC3 (MBL International PM036).

Techniques: Produced, Expressing, Flow Cytometry, Infection

HeLa cells were transduced to stably express a control scrambled shRNA (sh‐SCR) or shRNA targeting IFITM3 (sh‐IFITM3). The level of endogenous IFITMs in the presence or absence of IFN‐α (1,000 IU/ml for 48 h) was assessed by Western blot. HeLa sh‐SCR or sh‐IFITM3 treated or not with IFN‐α were infected with ZIKV HD78 (MOI 1), and the % of E‐positive cells was determined by flow cytometry at day 2 pi. Mean ± SEM of three independent experiments. HeLa sh‐SCR or sh‐IFITM3 cells were infected with ZIKV (MOI 1) for 2–4 days in the presence of propidium iodide (PI) for time‐lapse microscopy. The cells also expressed GFP to facilitate visualization of the cytoplasm and the vacuoles. Still images were extracted from (from HeLa sh‐IFITM3 infected cells) at the indicated time points. The area of the PI + signal was quantified for each condition. Nine fields from three independent experiments were analyzed and plotted as mean ± SEM. is a representative example of data used for quantification. The % of dead cells from 9 fields was visually scored at day 3 pi and plotted as mean. ZIKV E expression determined by flow cytometry and the proportion of cells displaying vacuoles was scored by visual examination of at least 200 cells at 24 h pi in HeLa sh‐SCR or sh‐IFITM3 cells infected with the indicated MOIs. Mean ± SEM of three independent experiments is shown. Data information: Statistical significance was determined using ANOVA and Bonferroni post‐tests. *** P < 0.001; ** P < 0.01; * P < 0.05.

Journal: The EMBO Journal

Article Title: Zika virus induces massive cytoplasmic vacuolization and paraptosis‐like death in infected cells

doi: 10.15252/embj.201695597

Figure Lengend Snippet: HeLa cells were transduced to stably express a control scrambled shRNA (sh‐SCR) or shRNA targeting IFITM3 (sh‐IFITM3). The level of endogenous IFITMs in the presence or absence of IFN‐α (1,000 IU/ml for 48 h) was assessed by Western blot. HeLa sh‐SCR or sh‐IFITM3 treated or not with IFN‐α were infected with ZIKV HD78 (MOI 1), and the % of E‐positive cells was determined by flow cytometry at day 2 pi. Mean ± SEM of three independent experiments. HeLa sh‐SCR or sh‐IFITM3 cells were infected with ZIKV (MOI 1) for 2–4 days in the presence of propidium iodide (PI) for time‐lapse microscopy. The cells also expressed GFP to facilitate visualization of the cytoplasm and the vacuoles. Still images were extracted from (from HeLa sh‐IFITM3 infected cells) at the indicated time points. The area of the PI + signal was quantified for each condition. Nine fields from three independent experiments were analyzed and plotted as mean ± SEM. is a representative example of data used for quantification. The % of dead cells from 9 fields was visually scored at day 3 pi and plotted as mean. ZIKV E expression determined by flow cytometry and the proportion of cells displaying vacuoles was scored by visual examination of at least 200 cells at 24 h pi in HeLa sh‐SCR or sh‐IFITM3 cells infected with the indicated MOIs. Mean ± SEM of three independent experiments is shown. Data information: Statistical significance was determined using ANOVA and Bonferroni post‐tests. *** P < 0.001; ** P < 0.01; * P < 0.05.

Article Snippet: The following antibodies were used: IFITM1 (Proteintech, 60074‐1‐Ig), IFITM2 (Proteintech, 66137‐1‐Ig), IFITM3 (Abcam, EPR5242/ab109429), actin (Santa Cruz Biotechnology), tubulin (Santa Cruz Biotechnology), and LC3 (MBL International PM036).

Techniques: Stable Transfection, shRNA, Western Blot, Infection, Flow Cytometry, Time-lapse Microscopy, Expressing

Effect of IFITM3 in HDFa cells. Left panel: The levels of endogenous IFITM3 were assessed by flow cytometry in HDFa transfected with a control siRNA or siRNA targeting IFITM3. Black curve: isotype control. Right panel: The cells were pretreated or not with IFN‐α (1,000 IU/ml for 48 h) and infected with ZIKV HD78 (MOI 1) for 24 h. Infected cells were scored by 4G2 staining and flow cytometry (right panel). Mean ± SEM from three independent experiments is shown. IFITM3 does not affect virus attachment to target cells. HeLa sh‐SCR or sh‐IFITM3 were incubated with ZIKV for 1 h at 4°C. The mean fluorescence intensity (MFI) of 4G2 staining was determined by flow cytometry. Black curve: isotype control. IFITM3 prevents intracellular accumulation of viral RNA. HeLa sh‐SCR or sh‐IFITM3 were infected with ZIKV for 2 or 4 h at 37°C. The black triangle indicates increasing amounts of virus (MOI 3 and 10). Virus remaining at the cell surface was removed by trypsin treatment. The cellular RNA was extracted, and RT‐qPCR was performed to quantify viral RNA. Mean ± SEM of three independent experiments. Data information: Statistical significance was determined using ANOVA test and Bonferroni post‐test. *** P < 0.001; * P < 0.05.

Journal: The EMBO Journal

Article Title: Zika virus induces massive cytoplasmic vacuolization and paraptosis‐like death in infected cells

doi: 10.15252/embj.201695597

Figure Lengend Snippet: Effect of IFITM3 in HDFa cells. Left panel: The levels of endogenous IFITM3 were assessed by flow cytometry in HDFa transfected with a control siRNA or siRNA targeting IFITM3. Black curve: isotype control. Right panel: The cells were pretreated or not with IFN‐α (1,000 IU/ml for 48 h) and infected with ZIKV HD78 (MOI 1) for 24 h. Infected cells were scored by 4G2 staining and flow cytometry (right panel). Mean ± SEM from three independent experiments is shown. IFITM3 does not affect virus attachment to target cells. HeLa sh‐SCR or sh‐IFITM3 were incubated with ZIKV for 1 h at 4°C. The mean fluorescence intensity (MFI) of 4G2 staining was determined by flow cytometry. Black curve: isotype control. IFITM3 prevents intracellular accumulation of viral RNA. HeLa sh‐SCR or sh‐IFITM3 were infected with ZIKV for 2 or 4 h at 37°C. The black triangle indicates increasing amounts of virus (MOI 3 and 10). Virus remaining at the cell surface was removed by trypsin treatment. The cellular RNA was extracted, and RT‐qPCR was performed to quantify viral RNA. Mean ± SEM of three independent experiments. Data information: Statistical significance was determined using ANOVA test and Bonferroni post‐test. *** P < 0.001; * P < 0.05.

Article Snippet: The following antibodies were used: IFITM1 (Proteintech, 60074‐1‐Ig), IFITM2 (Proteintech, 66137‐1‐Ig), IFITM3 (Abcam, EPR5242/ab109429), actin (Santa Cruz Biotechnology), tubulin (Santa Cruz Biotechnology), and LC3 (MBL International PM036).

Techniques: Flow Cytometry, Transfection, Infection, Staining, Incubation, Fluorescence, Quantitative RT-PCR

Time‐lapse analysis of the morphological changes observed in ZIKV‐infected cells. HeLa sh‐SCR and HeLa sh‐IFITM3 cells were infected with ZIKV HD78 (MOI 1) and recorded using time‐lapse microscopy. For each condition, about 20 individual cells that end up dying upon ZIKV infection were selected for further analysis. Morphological changes were visually scored for each cell. Results are representative of three independent experiments. HeLa sh‐SCR cells were infected or not with ZIKV HD78 (MOI 1) for 24 h, fixed, and stained to detect ZIKV E protein (red). One single Z slice representative of three independent experiments is shown. Scale bars: 5 μm.

Journal: The EMBO Journal

Article Title: Zika virus induces massive cytoplasmic vacuolization and paraptosis‐like death in infected cells

doi: 10.15252/embj.201695597

Figure Lengend Snippet: Time‐lapse analysis of the morphological changes observed in ZIKV‐infected cells. HeLa sh‐SCR and HeLa sh‐IFITM3 cells were infected with ZIKV HD78 (MOI 1) and recorded using time‐lapse microscopy. For each condition, about 20 individual cells that end up dying upon ZIKV infection were selected for further analysis. Morphological changes were visually scored for each cell. Results are representative of three independent experiments. HeLa sh‐SCR cells were infected or not with ZIKV HD78 (MOI 1) for 24 h, fixed, and stained to detect ZIKV E protein (red). One single Z slice representative of three independent experiments is shown. Scale bars: 5 μm.

Article Snippet: The following antibodies were used: IFITM1 (Proteintech, 60074‐1‐Ig), IFITM2 (Proteintech, 66137‐1‐Ig), IFITM3 (Abcam, EPR5242/ab109429), actin (Santa Cruz Biotechnology), tubulin (Santa Cruz Biotechnology), and LC3 (MBL International PM036).

Techniques: Infection, Time-lapse Microscopy, Staining

HeLa sh‐IFITM3 were infected with ZIKV HD78 or DV2 for 24 h or 5 days pi. Left panel: The levels of infection were determined by 4G2 staining and flow cytometry. Right panel: The proportion of cells displaying vacuoles was scored by visual examination of at least 200 cells at 24 h pi (right panel). Mean ± SEM of three independent experiments. One example of a representative field from (A) is shown for ZIKV (left) and DENV2 (right) infected cells at 24 h pi. Red arrows point to vacuole + cells. For each condition, an enlarged view of a vacuolated cell is shown. Examples of ZIKV‐ and DENV‐infected cells, with 4G2 staining and confocal microscopy analysis.

Journal: The EMBO Journal

Article Title: Zika virus induces massive cytoplasmic vacuolization and paraptosis‐like death in infected cells

doi: 10.15252/embj.201695597

Figure Lengend Snippet: HeLa sh‐IFITM3 were infected with ZIKV HD78 or DV2 for 24 h or 5 days pi. Left panel: The levels of infection were determined by 4G2 staining and flow cytometry. Right panel: The proportion of cells displaying vacuoles was scored by visual examination of at least 200 cells at 24 h pi (right panel). Mean ± SEM of three independent experiments. One example of a representative field from (A) is shown for ZIKV (left) and DENV2 (right) infected cells at 24 h pi. Red arrows point to vacuole + cells. For each condition, an enlarged view of a vacuolated cell is shown. Examples of ZIKV‐ and DENV‐infected cells, with 4G2 staining and confocal microscopy analysis.

Article Snippet: The following antibodies were used: IFITM1 (Proteintech, 60074‐1‐Ig), IFITM2 (Proteintech, 66137‐1‐Ig), IFITM3 (Abcam, EPR5242/ab109429), actin (Santa Cruz Biotechnology), tubulin (Santa Cruz Biotechnology), and LC3 (MBL International PM036).

Techniques: Infection, Staining, Flow Cytometry, Confocal Microscopy

HeLa sh‐SCR or sh‐IFITM3 cells were infected with ZIKV HD78 (MOI 1) for 24 h, fixed, and stained to detect E (red) and IFITM3 (yellow) proteins. The cells also expressed GFP to facilitate visualization of the cytoplasm and the vacuoles. One field representative of three independent experiments is shown. Detail of ZIKV‐infected cell in (A) showing large vacuoles and 4G2 staining (red). Images are average Z‐stacks of three consecutive slices. An additional example from a different field is also shown in the right panel. HeLa sh‐IFITM3 cells were infected with ZIKV HD78 (MOI 10) for 24 h, fixed, and subjected to FISH for the detection of viral ssRNA. Two examples from two fields are shown. A single Z slice is shown. Data information: Scale bars, 30 μm (A) and 5 μm (B, C).

Journal: The EMBO Journal

Article Title: Zika virus induces massive cytoplasmic vacuolization and paraptosis‐like death in infected cells

doi: 10.15252/embj.201695597

Figure Lengend Snippet: HeLa sh‐SCR or sh‐IFITM3 cells were infected with ZIKV HD78 (MOI 1) for 24 h, fixed, and stained to detect E (red) and IFITM3 (yellow) proteins. The cells also expressed GFP to facilitate visualization of the cytoplasm and the vacuoles. One field representative of three independent experiments is shown. Detail of ZIKV‐infected cell in (A) showing large vacuoles and 4G2 staining (red). Images are average Z‐stacks of three consecutive slices. An additional example from a different field is also shown in the right panel. HeLa sh‐IFITM3 cells were infected with ZIKV HD78 (MOI 10) for 24 h, fixed, and subjected to FISH for the detection of viral ssRNA. Two examples from two fields are shown. A single Z slice is shown. Data information: Scale bars, 30 μm (A) and 5 μm (B, C).

Article Snippet: The following antibodies were used: IFITM1 (Proteintech, 60074‐1‐Ig), IFITM2 (Proteintech, 66137‐1‐Ig), IFITM3 (Abcam, EPR5242/ab109429), actin (Santa Cruz Biotechnology), tubulin (Santa Cruz Biotechnology), and LC3 (MBL International PM036).

Techniques: Infection, Staining

Transmission electron microscopy (TEM) of non‐infected HeLa sh‐IFITM3 cells. TEM of ZIKV‐infected HeLa sh‐IFITM3 cells at 24 h pi displays cytoplasmic vacuolization (indicated with the letter V) and active virion production (enlarged on the right). Examples of ZIKV‐infected cells exhibiting large vacuoles. Enlarged views of dilated nuclear membranes in ZIKV‐infected cells. Data information: White arrows indicate the “membranous web” associated with viral production and/or accumulation.

Journal: The EMBO Journal

Article Title: Zika virus induces massive cytoplasmic vacuolization and paraptosis‐like death in infected cells

doi: 10.15252/embj.201695597

Figure Lengend Snippet: Transmission electron microscopy (TEM) of non‐infected HeLa sh‐IFITM3 cells. TEM of ZIKV‐infected HeLa sh‐IFITM3 cells at 24 h pi displays cytoplasmic vacuolization (indicated with the letter V) and active virion production (enlarged on the right). Examples of ZIKV‐infected cells exhibiting large vacuoles. Enlarged views of dilated nuclear membranes in ZIKV‐infected cells. Data information: White arrows indicate the “membranous web” associated with viral production and/or accumulation.

Article Snippet: The following antibodies were used: IFITM1 (Proteintech, 60074‐1‐Ig), IFITM2 (Proteintech, 66137‐1‐Ig), IFITM3 (Abcam, EPR5242/ab109429), actin (Santa Cruz Biotechnology), tubulin (Santa Cruz Biotechnology), and LC3 (MBL International PM036).

Techniques: Transmission Assay, Electron Microscopy, Infection

HeLa sh‐IFITM3 cells were infected with ZIKV HD78 (MOI 1) for 24 h, fixed, and stained for protein disulfide isomerase (PDI) (yellow). Two representative cells for each condition over three independent experiments are shown. Images are average Z‐stacks of three consecutive slices. Scale bars, 10 μm. HeLa sh‐IFITM3 cells stably expressing a fluorescent ER‐tracker (DsRed2‐ER) shown in red were infected with ZIKV HD78 (MOI 1) for 2 days for time‐lapse microscopy. Still images were extracted from at the indicated time points. HeLa sh‐IFITM3 were infected with ZIKV HD78 (MOI 0.1 or 1) for 2 h and then treated with or without mycolactone (20 nM), an inhibitor of the Sec61 translocon. After 24 h, cells were stained for viral E protein and analyzed by confocal microscopy (left panels). ZIKV E expression was determined by flow cytometry, and the proportion of cells displaying vacuoles was scored by visual examination of at least 200 cells (right). Results are mean ± SEM of three independent experiments. Statistical significance was determined by unpaired t ‐tests. *** P < 0.001. Scale bars, 10 μm. ZIKV‐induced ER stress. Levels of IRE‐I, PERK, and ATF6 mRNA were determined by RT–PCR at 24 and 48 h pi. Results are mean ± SEM for three independent experiments. Statistical significance was determined by unpaired t ‐tests. *** P < 0.001; ** P < 0.01; * P < 0.05; ns, P > 0.05.

Journal: The EMBO Journal

Article Title: Zika virus induces massive cytoplasmic vacuolization and paraptosis‐like death in infected cells

doi: 10.15252/embj.201695597

Figure Lengend Snippet: HeLa sh‐IFITM3 cells were infected with ZIKV HD78 (MOI 1) for 24 h, fixed, and stained for protein disulfide isomerase (PDI) (yellow). Two representative cells for each condition over three independent experiments are shown. Images are average Z‐stacks of three consecutive slices. Scale bars, 10 μm. HeLa sh‐IFITM3 cells stably expressing a fluorescent ER‐tracker (DsRed2‐ER) shown in red were infected with ZIKV HD78 (MOI 1) for 2 days for time‐lapse microscopy. Still images were extracted from at the indicated time points. HeLa sh‐IFITM3 were infected with ZIKV HD78 (MOI 0.1 or 1) for 2 h and then treated with or without mycolactone (20 nM), an inhibitor of the Sec61 translocon. After 24 h, cells were stained for viral E protein and analyzed by confocal microscopy (left panels). ZIKV E expression was determined by flow cytometry, and the proportion of cells displaying vacuoles was scored by visual examination of at least 200 cells (right). Results are mean ± SEM of three independent experiments. Statistical significance was determined by unpaired t ‐tests. *** P < 0.001. Scale bars, 10 μm. ZIKV‐induced ER stress. Levels of IRE‐I, PERK, and ATF6 mRNA were determined by RT–PCR at 24 and 48 h pi. Results are mean ± SEM for three independent experiments. Statistical significance was determined by unpaired t ‐tests. *** P < 0.001; ** P < 0.01; * P < 0.05; ns, P > 0.05.

Article Snippet: The following antibodies were used: IFITM1 (Proteintech, 60074‐1‐Ig), IFITM2 (Proteintech, 66137‐1‐Ig), IFITM3 (Abcam, EPR5242/ab109429), actin (Santa Cruz Biotechnology), tubulin (Santa Cruz Biotechnology), and LC3 (MBL International PM036).

Techniques: Infection, Staining, Stable Transfection, Expressing, Time-lapse Microscopy, Confocal Microscopy, Flow Cytometry, Reverse Transcription Polymerase Chain Reaction

HeLa sh‐IFITM3 were infected with ZIKV HD 78 (MOI 1) for 24 h in the presence or absence of mycolactone (20 nM) added at 2 h (mycolactone early) or 15 h pi (mycolactone late). Brefeldin A (0.5 μg/ml) was added during the 24 h of infection. The levels of infection were determined by 4G2 staining and flow cytometry. Results are mean ± SEM of three independent infections. 293T cells expressing WT Sec61 or a mutated Sec61 resistant to mycolactone (Sec61‐mut) were infected with ZIKV HD 78 (MOI 1) for 3 days in the presence or absence of mycolactone (20 nM). The levels of infection were determined by 4G2 staining and flow cytometry. Results are mean ± SEM of three independent infections. Data information: Statistical significance was determined using ANOVA and Bonferroni post‐tests. *** P < 0.001; ** P < 0.01; ns, P > 0.05.

Journal: The EMBO Journal

Article Title: Zika virus induces massive cytoplasmic vacuolization and paraptosis‐like death in infected cells

doi: 10.15252/embj.201695597

Figure Lengend Snippet: HeLa sh‐IFITM3 were infected with ZIKV HD 78 (MOI 1) for 24 h in the presence or absence of mycolactone (20 nM) added at 2 h (mycolactone early) or 15 h pi (mycolactone late). Brefeldin A (0.5 μg/ml) was added during the 24 h of infection. The levels of infection were determined by 4G2 staining and flow cytometry. Results are mean ± SEM of three independent infections. 293T cells expressing WT Sec61 or a mutated Sec61 resistant to mycolactone (Sec61‐mut) were infected with ZIKV HD 78 (MOI 1) for 3 days in the presence or absence of mycolactone (20 nM). The levels of infection were determined by 4G2 staining and flow cytometry. Results are mean ± SEM of three independent infections. Data information: Statistical significance was determined using ANOVA and Bonferroni post‐tests. *** P < 0.001; ** P < 0.01; ns, P > 0.05.

Article Snippet: The following antibodies were used: IFITM1 (Proteintech, 60074‐1‐Ig), IFITM2 (Proteintech, 66137‐1‐Ig), IFITM3 (Abcam, EPR5242/ab109429), actin (Santa Cruz Biotechnology), tubulin (Santa Cruz Biotechnology), and LC3 (MBL International PM036).

Techniques: Infection, Staining, Flow Cytometry, Expressing

A Comparison of large cytoplasmic vacuoles induced by ZIKV or cyclosporine A. HeLa sh‐IFITM3 expressing the fluorescent ER‐tracker were infected with ZIKV HD 78 (MOI 1) or treated with cyclosporin A (10 μM) for 2 days and analyzed by time‐lapse microscopy. Two representative still images for each condition are shown. B, C HeLa sh‐IFITM3 were infected with ZIKV HD 78 (MOI 1) for 24 h in the presence or absence of the pan PI3K inhibitor Wortmannin, the class 1‐specific PI3K inhibitor ZSTK474 (1 μM), the Akt inhibitor Triciribine (Akt V) (20 μM), the class 3‐specific PI3K (vps34) inhibitor SAR405 (1 μM), or the pan‐PI3K inhibitor 3MA (5 mM). (B) The percentage of E + cells was quantified with 4G2 staining and flow cytometry. (C) In parallel, the proportion of cells displaying vacuoles was scored by visual examination of at least 200 cells. Results are mean ± SEM for three independent experiments. Statistical significance was determined using unpaired t ‐tests. *** P < 0.001; ns, P > 0.05. D, E HeLa sh‐IFITM3 were infected with ZIKV HD 78 (MOI 1) for 24 or 48 h in the presence or absence of the pan‐caspase inhibitor ZVAD‐FMK. (D) The percentage of cells expressing activated caspase‐3 (left panel) and the percentage of dying cells quantified with live/dead staining (right panel) were measured by flow cytometry. The apoptosis inducer TRAIL was used as a control. (E) The percentage of E + cells was quantified with 4G2 staining and flow cytometry (left panel). In parallel, the proportion of cells displaying vacuoles was scored by visual examination of at least 200 cells (right panel). Results are mean ± SEM for three independent experiments. Statistical significance was determined using ANOVA and Bonferroni post‐tests (D) or unpaired t ‐tests (E).*** P < 0.001; * P < 0.05; ns, P > 0.05.

Journal: The EMBO Journal

Article Title: Zika virus induces massive cytoplasmic vacuolization and paraptosis‐like death in infected cells

doi: 10.15252/embj.201695597

Figure Lengend Snippet: A Comparison of large cytoplasmic vacuoles induced by ZIKV or cyclosporine A. HeLa sh‐IFITM3 expressing the fluorescent ER‐tracker were infected with ZIKV HD 78 (MOI 1) or treated with cyclosporin A (10 μM) for 2 days and analyzed by time‐lapse microscopy. Two representative still images for each condition are shown. B, C HeLa sh‐IFITM3 were infected with ZIKV HD 78 (MOI 1) for 24 h in the presence or absence of the pan PI3K inhibitor Wortmannin, the class 1‐specific PI3K inhibitor ZSTK474 (1 μM), the Akt inhibitor Triciribine (Akt V) (20 μM), the class 3‐specific PI3K (vps34) inhibitor SAR405 (1 μM), or the pan‐PI3K inhibitor 3MA (5 mM). (B) The percentage of E + cells was quantified with 4G2 staining and flow cytometry. (C) In parallel, the proportion of cells displaying vacuoles was scored by visual examination of at least 200 cells. Results are mean ± SEM for three independent experiments. Statistical significance was determined using unpaired t ‐tests. *** P < 0.001; ns, P > 0.05. D, E HeLa sh‐IFITM3 were infected with ZIKV HD 78 (MOI 1) for 24 or 48 h in the presence or absence of the pan‐caspase inhibitor ZVAD‐FMK. (D) The percentage of cells expressing activated caspase‐3 (left panel) and the percentage of dying cells quantified with live/dead staining (right panel) were measured by flow cytometry. The apoptosis inducer TRAIL was used as a control. (E) The percentage of E + cells was quantified with 4G2 staining and flow cytometry (left panel). In parallel, the proportion of cells displaying vacuoles was scored by visual examination of at least 200 cells (right panel). Results are mean ± SEM for three independent experiments. Statistical significance was determined using ANOVA and Bonferroni post‐tests (D) or unpaired t ‐tests (E).*** P < 0.001; * P < 0.05; ns, P > 0.05.

Article Snippet: The following antibodies were used: IFITM1 (Proteintech, 60074‐1‐Ig), IFITM2 (Proteintech, 66137‐1‐Ig), IFITM3 (Abcam, EPR5242/ab109429), actin (Santa Cruz Biotechnology), tubulin (Santa Cruz Biotechnology), and LC3 (MBL International PM036).

Techniques: Expressing, Infection, Time-lapse Microscopy, Staining, Flow Cytometry

The class 1 PI3K inhibitor blocks autophagy assessed by LC3 clustering in HeLa sh‐IFITM3 treated with rapamycin (5 mM) and concanamycin A (1 μM), which prevents fusion of phagosomes with lysosomes. HeLa cells expressing a shRNA control or a shRNA targeting LC3 were infected with ZIKV HD78 (moi 1) for 24 h, and the % of E + cells as well as the % of vacuole‐containing cells were quantified by flow cytometry and microscopy, respectively. The efficiency of silencing was assessed by Western blot (left panel). Results are shown as mean ± SEM from three independent experiments.

Journal: The EMBO Journal

Article Title: Zika virus induces massive cytoplasmic vacuolization and paraptosis‐like death in infected cells

doi: 10.15252/embj.201695597

Figure Lengend Snippet: The class 1 PI3K inhibitor blocks autophagy assessed by LC3 clustering in HeLa sh‐IFITM3 treated with rapamycin (5 mM) and concanamycin A (1 μM), which prevents fusion of phagosomes with lysosomes. HeLa cells expressing a shRNA control or a shRNA targeting LC3 were infected with ZIKV HD78 (moi 1) for 24 h, and the % of E + cells as well as the % of vacuole‐containing cells were quantified by flow cytometry and microscopy, respectively. The efficiency of silencing was assessed by Western blot (left panel). Results are shown as mean ± SEM from three independent experiments.

Article Snippet: The following antibodies were used: IFITM1 (Proteintech, 60074‐1‐Ig), IFITM2 (Proteintech, 66137‐1‐Ig), IFITM3 (Abcam, EPR5242/ab109429), actin (Santa Cruz Biotechnology), tubulin (Santa Cruz Biotechnology), and LC3 (MBL International PM036).

Techniques: Expressing, shRNA, Infection, Flow Cytometry, Microscopy, Western Blot